Folders and files
| Name | Name | Last commit date | ||
|---|---|---|---|---|
Repository files navigation
CUFFLINKS ---------------------------- Cufflinks is a reference-guided assembler for RNA-Seq experiments. It simultaneously assembles transcripts from reads and estimates their relative abundances, without using a reference annotation. The software expects as input RNA-Seq read alignments in SAM format (http://samtools.sourceforge.net). Here's an example spliced read alignment record: s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:- This record includes a custom tag used by Cufflinks to determine the strand of the mRNA from which this read originated. Often, RNA-Seq experiments lose strand information, and so reads will map to either strand of the genome. However, strandedness of spliced alignments can often be inferred from the orientation of consensus splice sites, and Cufflinks requires that spliced aligments have the custom strand tag XS, which has SAM attribute type "A", and can take values of "+" or "-". If your RNA-Seq protocol is strand specific, including this tag for all alignments, including unspliced alignments, will improve the assembly quality. The SAM records MUST BE SORTED by reference coordinate, like so: sort -k 3,3 -k 4,4n hits.sam The program is fully threaded, and when running with multiple threads, should be run on a machine with plenty of RAM. 4 GB per thread is probably reasonable for most experiments. Since many experiments feature a handful of genes that are very abundantly transcribed, Cufflinks will spend much of its time assembling" a few genes. When using more than one thread, Cufflinks may appear to "hang" while these genes are being assembled. Cufflinks assumes that library fragment lengths are size selected and normally distributed. When using paired end RNA-Seq reads, you must take care to supply Cufflinks with the mean and variance on the inner distances between mate pairs. For the moment, Cufflinks doesn't support assembling mixtures of paired end reads from different fragment size distributions. Mixtures of single ended reads (of varying lengths) with paired ends are supported. Cufflinks also assumes that the donor does not contain major structural variations with respect to the reference. Tumor genomes are often highly rearranged, and while Cufflinks may eventually identify gene fusions and gracefully handle genome breakpoints, users are encouraged to be careful when using Cufflinks on tumor RNA-Seq experiments. The full manual may be found at http://cufflinks.cbcb.umd.edu CUFFCOMPARE ---------------------------- Please see http://cole-trapnell-lab.github.io/cufflinks/manual REQUIREMENTS --------------------------- Cufflinks is a standalone tool that requires gcc 4.0 or greater, and runs on Linux and OS X. It depends on Boost (http://www.boost.org) version 1.38 or higher. REFERENCES --------------------------- Cufflinks builds on many ideas, including some proposed in the following papers: Ali Mortazavi, Brian A Williams, Kenneth McCue, Lorian Schaeffer and Barbara Wold, "Mapping and quantifying mammalian transcriptomes by RNA-Seq",Nature Methods, volume 5, 621 - 628 (2008) Hui Jiang and Wing Hung Wong, "Statistical Inferences for isoform expression", Bioinformatics, 2009 25(8):1026-1032 Nicholas Eriksson, Lior Pachter, Yumi Mitsuya, Soo-Yon Rhee, Chunlin Wang, Baback Gharizadeh, Mostafa Ronaghi, Robert W. Shafer, Niko Beerenwinkel, "Viral population estimation using pyrosequencing", PLoS Computational Biology, 4(5):e1000074