A tool for high-quality clustering and consensus generation from Oxford Nanopore amplicon reads.
Speconsense is a specialized tool for generating high-quality consensus sequences from Oxford Nanopore Technology (ONT) amplicon data. It is specifically designed as an experimental alternative to NGSpeciesID in the fungal DNA barcoding pipeline.
The key features of Speconsense include:
- Robust clustering of amplicon reads using either Markov Clustering (MCL) graph-based or greedy algorithms
- Automatic variant phasing: Detects variant positions within clusters and splits reads into separate haplotypes
- Post-phasing refinement: Reads can move between clusters within an identity group, and previously-discarded reads can be re-admitted, when consensus concordance supports it
- Statistical variant validation (CER): Each cluster is annotated with a context-aware Critical Error Rate factor measuring how implausible it is as basecaller-noise replicates of a larger peer
- Cluster homogeneity (err_factor): A peer-independent metric for whether a cluster's reads are internally consistent with the assumed sequencing-noise profile
- Automatic merging of clusters with identical or homopolymer-equivalent consensus sequences
- High-quality consensus generation using SPOA, with MAD-based outlier removal at final consensus
- Primer trimming for clean consensus sequences
- Read identity metrics for quality assessment
- IUPAC ambiguity codes for unphased heterozygous positions
- Optimized for fungal amplicon datasets but suitable for any amplicon sequencing application
- Python 3.8 or higher
- External dependencies:
- SPOA (SIMD POA) - Required (install via conda)
- MCL - Optional but recommended for graph-based clustering (install via conda)
- vsearch - Optional, required for scalability mode with large datasets (install via conda)
- pyitsx + ITSx - Optional, for HMM-based orientation (
--orient-mode pyitsx)
The easiest way to install speconsense is directly from GitHub using pip. We recommend using a virtual environment to avoid dependency conflicts:
# Create and activate a virtual environment (recommended)
python -m venv speconsense-env
source speconsense-env/bin/activate # On Windows: speconsense-env\Scripts\activate
# Install directly from GitHub
pip install git+https://github.com/joshuaowalker/speconsense.git
# External dependencies need to be installed separately
# SPOA: conda install bioconda::spoa
# MCL: conda install bioconda::mcl (optional but recommended)After installation, the tools will be available as command-line programs:
speconsense- Main clustering and consensus toolspeconsense-summarize- Post-processing and summary toolspeconsense-synth- Synthetic read generator for testingspeconsense-fit-error-model- Fit a custom q_ctx error model from a finished speconsense run (see Fitting a Custom Error Model)
To deactivate the virtual environment when done:
deactivateMCL (Markov Clustering) - Recommended:
# Via conda (easiest)
conda install bioconda::mcl
# Or from source (more complex)
# See https://micans.org/mcl/ for source installationSPOA (SIMD POA) - Required:
# Via conda (easiest)
conda install bioconda::spoa
# Or install from GitHub releases or build from source
# See https://github.com/rvaser/spoa for source installation instructionsvsearch - Optional (for scalability mode):
# Via conda (easiest)
conda install bioconda::vsearch
# Or download from https://github.com/torognes/vsearch/releasespyitsx + ITSx - Optional (for HMM-based orientation):
# pyitsx (Python package)
pip install pyitsx
# ITSx (provides HMM profiles that pyitsx uses)
conda install bioconda::itsxNote: If the mcl tool is not available, speconsense will automatically fall back to the greedy clustering algorithm.
speconsense input.fastqBy default, this will:
- Cluster reads using graph-based Markov Clustering (MCL) algorithm
- Merge clusters with identical consensus sequences
- Generate a consensus sequence for each cluster
- Output FASTA files containing consensus sequences
# Use greedy clustering algorithm instead of Markov Clustering
speconsense input.fastq --algorithm greedy
# Set minimum cluster size
speconsense input.fastq --min-size 10
# Set minimum identity threshold for clustering (default: 0.9)
speconsense input.fastq --min-identity 0.85
# Control the maximum sample size for consensus generation (default: 100)
speconsense input.fastq --max-sample-size 200
# Specify output directory (default: clusters)
speconsense input.fastq --output-dir results/
# Disable automatic variant phasing
speconsense input.fastq --disable-position-phasing
# Using short form for output directory
speconsense input.fastq -O my_results/Profiles save parameter configurations for different workflows:
# List available profiles
speconsense --list-profiles
# Use a profile (CLI arguments override profile values)
speconsense input.fastq -p herbarium
speconsense input.fastq -p herbarium --min-size 10Bundled profiles:
compressed— Compress variants into minimal IUPAC consensus sequences (aggressive merging with indels, 20% thresholds, 20% selection size ratio)herbarium— High-recall for degraded DNA/type specimens (CER and err_factor filters disabled to surface weak-signal variants for review)largedata— Experimental settings for large input files (tightergroup-identityto keep identity groups small)nostalgia— Simulate older bioinformatics pipelines (disables read reassignment, discard recovery, CER and err_factor filters)strict— High-precision for confident results (per-groupselect-min-size-ratio)
On first use, an example.yaml template is created in ~/.config/speconsense/profiles/ — copy and edit it to create custom profiles.
speconsense extracts distinct biological sequences from raw reads within a single specimen. It separates true biological variation (alleles, loci, contaminants) from sequencing noise by clustering reads and generating consensus sequences. Philosophy: split rather than conflate — better to produce separate clusters that can be merged downstream than to lose real biological distinctions.
speconsense-summarize curates and consolidates consensus sequences for downstream analysis. It handles residual ambiguity that consensus generation cannot resolve — primarily minor SNP differences that may represent the same biological entity — groups related variants, selects representatives, and can analyze patterns across a run. Philosophy: conservative simplification — merge only what is clearly equivalent, preserve distinctions when uncertain.
| Aspect | speconsense | speconsense-summarize |
|---|---|---|
| Input | Raw reads | Consensus sequences |
| Scope | Single specimen | Single or multiple specimens |
| Goal | Discovery/enumeration | Curation/simplification |
| Error model | Read-level noise | Residual ambiguity |
| Bias | Prefer over-splitting | Conservative merging |
After running speconsense, use the summarize tool to process and refine outputs:
# Generate summary with default settings
speconsense-summarize
# Custom minimum RiC (Reads in Consensus) threshold
speconsense-summarize --min-ric 5
# Process specific source directory and custom output
speconsense-summarize --source /path/to/speconsense/output --summary-dir MyResultsVariant Detection and Haplotype Phasing:
Speconsense can detect and isolate sequence variants within specimens (aka "haplotype phasing"). The graph-based clustering algorithm excels at discriminating between variants, and a multi-phase post-processing pipeline (read reassignment, discard recovery, second phasing pass, CER validation) refines the result. Core groups every variant into a complete-linkage identity group (gid) and assigns each variant a within-group rank (vid); these labels travel through to summarize via FASTA-header fields. speconsense-summarize honors that grouping rather than re-clustering, and provides:
- MSA-based variant merging with IUPAC ambiguity codes and size-weighted consensus, applied within each identity group
- Cross-primer overlap merging across identity groups (for primer-pool workflows)
- CER and err_factor filtering to route low-confidence variants to a separate
.ns/.lqtrack - Size-based variant selection with configurable limits per group
For detailed information on variant handling options, see the Advanced Post-Processing section below.
Speconsense is designed to replace the NGSpeciesID step in the ONT DNA Barcoding Fungal Amplicons protocol. Here's a complete workflow:
1. Demultiplex with Specimux
Follow the protocol through the "Demultiplex the Reads with Specimux" step.
2. Run Speconsense
Replace the NGSpeciesID step with speconsense:
# Instead of NGSpeciesID:
# ls *.fastq | parallel NGSpeciesID --ont --consensus --t 1 --abundance_ratio 0.2 ...
# Use Speconsense:
ls *.fastq | parallel speconsense {}3. Post-process with Speconsense-Summarize
Process the outputs to prepare for downstream analysis:
speconsense-summarizeThis will create a __Summary__/ directory with:
summary.fasta- All final consensus sequences (merged variants only)- Individual FASTA files per specimen
summary.txt- Statistics and metricsquality_report.txt- Prioritized list of sequences with potential quality concernsFASTQ Files/- Reads contributing to each final consensusvariants/- Pre-merge variant FASTA and FASTQ files (for merged sequences)
Filenames use the identity group rank (gid) and within-group variant rank (vid) end-to-end: {sample_name}-{gid}.v{vid}-RiC{size}. There is no separate "original" namespace.
For each specimen, Speconsense generates:
-
Main consensus FASTA:
{sample_name}-all.fasta- Contains all consensus sequences for the specimen (one per cluster), tagged with
gid=/vid=andcer_factor=/err_factor=headers
- Contains all consensus sequences for the specimen (one per cluster), tagged with
-
Debug directory (
cluster_debug/):{sample_name}-{gid}.v{vid}-RiC{size}-reads.fastq: Original reads in each cluster{sample_name}-{gid}.v{vid}-RiC{size}-sampled.fastq: Sampled reads used for consensus generation{sample_name}-{gid}.v{vid}-RiC{size}-untrimmed.fasta: Untrimmed consensus sequences{sample_name}-discards.fastq: Reads discarded across the pipeline (only when--collect-discardsis set)
-
Metadata directory (
metadata/):{sample_name}_metadata.json: Full per-cluster diagnostics including pipeline phase counts, MAD outlier drops, per-clustercer_details(peer id, K, p*, joint q, per-position context tags and q_ctx values, reference idx) for replaying CER decisions offline, and rawobs_sum/exp_sum/colsforerr_factorreproduction
speconsense-summarize honors core's identity groups (parsed from gid=/vid= headers) and applies cross-primer overlap merging, MSA-based variant merging within each group, CER and err_factor filtering, and variant selection. It refuses to process FASTA inputs that lack gid=/vid= headers — re-run speconsense if upgrading from a pre-0.8 output directory.
Creates the __Summary__/ directory with:
- Individual FASTA files:
{sample_name}-{gid}.v{vid}-RiC{reads}.fasta(one per passing variant) - Combined file:
summary.fasta— all passing final consensus sequences (excludes.raw,.ns, and.lqfiles) - Statistics:
summary.txt— sequence counts and metrics - Quality report:
quality_report.txt— inspection-oriented report (executive summary, passed variants worth inspecting, possible rescues, overlap merge details, run-wide parameter signals, pipeline activity) - Log file:
summarize_log.txt— complete processing log
{sample_name}-{gid}.v{vid}-RiC{reads}.fastq
{sample_name}-{gid}.v{vid}.raw{N}-RiC{reads}.fasta— FASTA for pre-merge variant N (when variants were merged){sample_name}-{gid}.v{vid}.ns-RiC{reads}.fasta— variants routed off the primary track because theircer_factorfell below--min-cer-factor(default1.0){sample_name}-{gid}.v{vid}.lq-RiC{reads}.fasta— variants routed off the primary track because theirerr_factorexceeded--max-err-factor(default1.5);.lqtakes precedence over.nswhen both fire- FASTQ Files/ (matching FASTQs for
.raw,.ns,.lqrecords)
{specimen}.txt— ASCII hierarchy of every variant in a specimen (passing,.ns,.lqtogether), grouped by core identity group. Each non-anchor variant branches from the larger-size peer with the highest pairwise identity, with a one-line edit summary (substitutions, single-nt indels, short ≤3 nt indels, long indels) versus that parent. Filtered variants carry the on-disk status marker (-1.v4.ns,-1.v8.lq)
The same -{gid}.v{vid} schema is used everywhere. There is no separate "original" namespace:
| Field | Meaning | Source |
|---|---|---|
gid |
Identity group rank within the specimen (1 = largest) | Core (scipy.cluster.hierarchy.fcluster complete linkage at --group-identity) |
vid |
Variant rank within the identity group (1 = anchor / largest) | Core (size-ordered) |
.raw{N} |
Pre-merge component of a merged variant | Summarize |
.ns |
Variant routed off the primary track by --min-cer-factor |
Summarize |
.lq |
Variant routed off the primary track by --max-err-factor |
Summarize |
clusters/
├── sample-all.fasta # All consensus sequences
├── cluster_debug/
│ ├── sample-1.v1-RiC120-reads.fastq
│ ├── sample-1.v1-RiC120-sampled.fastq
│ └── sample-1.v1-RiC120-untrimmed.fasta
└── metadata/
└── sample_metadata.json # Pipeline diagnostics + cer_details
__Summary__/
├── sample-1.v1-RiC120.fasta # Anchor of group 1 (passing)
├── sample-1.v2-RiC45.fasta # Second variant in group 1
├── sample-2.v1-RiC30.fasta # Anchor of group 2
├── summary.fasta # All passing consensus sequences
├── summary.txt # Statistics
├── quality_report.txt # Quality assessment report
├── summarize_log.txt # Processing log
├── FASTQ Files/
│ ├── sample-1.v1-RiC120.fastq
│ ├── sample-1.v2-RiC45.fastq
│ └── sample-2.v1-RiC30.fastq
├── trees/
│ └── sample.txt # Per-specimen variant hierarchy
└── variants/
├── sample-1.v1.raw1-RiC75.fasta # Pre-merge component of merged variant
├── sample-1.v1.raw2-RiC45.fasta
├── sample-1.v3.ns-RiC18.fasta # Failed --min-cer-factor
├── sample-2.v2.lq-RiC22.fasta # Failed --max-err-factor
└── FASTQ Files/ # Matching FASTQs for .raw / .ns / .lq
Consensus sequence headers contain metadata fields separated by spaces:
Core Fields (Always Present):
size=N— Total number of raw sequence reads in the clusterric=N— Reads in Consensus — Number of reads actually used for consensus generation (may be less thansizedue to sampling limits)gid=N— Identity group rank within the specimen (1 = largest)vid=N— Variant rank within the identity group (1 = anchor / largest)
Statistical Validation Fields:
cer_factor=X.X— Per-position multiplicative error rate inflation needed for the cluster to be plausible as basecaller-noise replicates of a larger peer. Higher = more confident the cluster is a real variant.cer_factor=Nonemeans anchor or no comparison peer found (always passes filtering)err_factor=X.X— Cluster homogeneity ratio (observed disagreement / expected from q_ctx). Values near 1.0 indicate reads consistent with basecaller noise; values ≫ 1.0 indicate internal heterogeneity beyond what sequencing noise produces
Optional Fields:
rawric=N+N+...— RiC values of.rawsource variants (pre-merge, largest-first; only present in merged variants fromspeconsense-summarize)rawlen=N+N+...— Original sequence lengths before overlap merging (largest-first; only present in overlap-merged variants)snp=N— Number of SNP positions from IUPAC merging (only present in merged variants)ambig=N— Count of IUPAC ambiguity codes in consensus (Y, R, W, S, K, M, etc.)length=N— Sequence length in bases (via--fasta-fieldsoption)primers=list— Comma-separated list of detected primer names (e.g.,primers=ITS1F,ITS4)rid=X.X— Mean read identity percentage (0–100%; via--fasta-fields qcpreset)rid_min=X.X— Minimum read identity percentage (worst-case read; via--fasta-fields qcpreset)
Example Headers:
# Anchor of group 1, passing both CER and err_factor checks:
>sample-1.v1 size=120 ric=100 gid=1 vid=1 cer_factor=None err_factor=1.02 primers=ITS1F,ITS4
# Second variant in group 1, statistically validated against the anchor:
>sample-1.v2 size=45 ric=45 gid=1 vid=2 cer_factor=12.4 err_factor=0.97 primers=ITS1F,ITS4
# Merged variant from speconsense-summarize:
>sample-1.v1 size=250 ric=250 gid=1 vid=1 rawric=100+89+61 snp=2 ambig=2 cer_factor=None err_factor=1.05 primers=ITS1F,ITS4
# Overlap-merged variant (different-length sequences merged):
>sample-1.v1 size=471 ric=471 gid=1 vid=1 rawric=248+223 rawlen=630+361 primers=ITS1F,ITS4
# QC preset (--fasta-fields qc):
>sample-1.v1 size=250 ric=250 gid=1 vid=1 length=589 rid=98.5 ambig=1
Notes:
- Use
--fasta-fieldsto customize which fields appear in output headers (see Customizing FASTA Header Fields) - Read identity metrics (
rid,rid_min) reflect homopolymer-normalized sequence identity cer_factoris filtered by--min-cer-factor(default1.0) in summarize;err_factorby--max-err-factor(default1.5)- Variant merging only occurs between sequences with identical primer sets, within the same identity group (or via cross-primer overlap merging across groups)
snpcounts positions where IUPAC codes were introduced during merging;ambigcounts total ambiguity codes in the final sequence- Per-position CER reproduction data (peer id, K, p*, joint q, context tags, q_ctx values) lives in
clusters/metadata/{specimen}_metadata.json, not in the FASTA header
For large datasets (thousands of sequences), speconsense uses external tools to accelerate pairwise comparison operations. Scalability mode is enabled by default for datasets with 1000+ sequences.
# Default: scalability enabled for datasets with 1000+ sequences
speconsense input.fastq
# Custom threshold: enable scalability only for datasets with 500+ sequences
speconsense input.fastq --scale-threshold 500
# Disable scalability entirely (use brute-force for all sizes)
speconsense input.fastq --scale-threshold 0
# Same options work for speconsense-summarize
speconsense-summarize --scale-threshold 500 --source clusters/The threshold parameter allows you to run a single command across multiple specimens of varying sizes. Smaller specimens will use brute-force (which has less overhead for small inputs), while larger specimens will use vsearch acceleration.
Scalability mode requires vsearch to be installed:
conda install bioconda::vsearchIf vsearch is not available, speconsense will automatically fall back to brute-force computation.
Scalability mode uses a two-stage approach to reduce the O(n^2) pairwise comparison cost:
- Fast candidate finding: vsearch quickly identifies approximate sequence matches using heuristic search
- Exact scoring: Only candidate pairs are scored using the full alignment algorithm
This reduces the computational complexity from O(n^2) to approximately O(n x k), where k is the number of candidates per sequence.
Based on benchmarking, the break-even point is approximately 1000 sequences:
- Below 1000 sequences: brute-force is faster (less overhead)
- Above 1000 sequences: vsearch acceleration provides significant speedup
- At 10,000 sequences: ~10x faster than brute-force
- The scalability layer is designed to be backend-agnostic; future versions may support alternative tools (BLAST, minimap2, etc.)
- For summarize's HAC clustering, scalability is most effective when there are many consensus sequences to cluster
- Scalability mode produces identical or near-identical results to brute-force mode
The --threads option controls internal parallelism (vsearch, SPOA consensus generation). Use 0 for auto-detect.
Default behavior differs between tools:
speconsense: defaults to--threads 1(safe for GNU parallel workflows)speconsense-summarize: defaults to--threads 0(auto-detect, since it runs once across all specimens)
# Many speconsense jobs via parallel - single-threaded by default (safe)
ls *.fastq | parallel speconsense {}
# Single large speconsense job - enable internal parallelism
speconsense large_dataset.fastq --threads 0
# speconsense-summarize auto-detects threads by default
speconsense-summarize --source clusters/--collect-discards writes all discarded reads (unclustered, MAD outliers, hard-floor or noise-filter dropouts, size-filtered clusters) to cluster_debug/{sample}-discards.fastq for inspection. Useful when investigating why a specimen lost reads.
Speconsense offers two clustering approaches with different characteristics:
- Constructs a similarity graph between reads and applies the Markov Clustering algorithm to identify clusters
- Tends to produce more clusters by discriminating between sequence variants within a specimen
- Suitable when you want to identify multiple variants per specimen and are willing to interpret complex results
- Excellent for detecting subtle sequence differences and biological variation
- Relatively fast with high-quality results for most datasets
Why MCL? Markov Clustering was chosen for its ability to detect natural communities in densely connected graphs without requiring a priori specification of cluster numbers. The algorithm simulates flow in the graph, causing flow to spread within natural clusters and evaporate between different clusters. By varying a single parameter (inflation), MCL can detect clusters at different scales of granularity. MCL has proven highly effective in bioinformatics applications, particularly for protein family detection in large-scale sequence databases, making it well-suited for identifying sequence variants in amplicon data.
- Uses greedy star clustering that iteratively selects the sequence with the most similar neighbors as cluster centers
- Tends to produce fewer, simpler clusters by focusing on well-separated sequences
- Excellent at discriminating between distinct targets (e.g., primary sequence vs. contaminant)
- Usually does not separate variants within the same biological sequence
- Suitable when you want a fast algorithm with minimal complexity in interpreting results
- Ideal for applications where one consensus per specimen is sufficient
Use --algorithm greedy when:
- You want one clear consensus sequence per specimen
- Speed is prioritized over detailed variant detection
- You prefer simpler output interpretation
- Your dataset has well-separated sequences (targets vs. contaminants)
Use --algorithm graph (default) when:
- You want to detect sequence variants within specimens
- You're willing to evaluate multiple consensus sequences per specimen
- You need fine-grained discrimination between similar sequences
- You want the most comprehensive analysis of sequence diversity
- Note: Use
speconsense-summarizeafter clustering to manage multiple variants per specimen. Key options include--merge-position-countfor merging variants differing by few SNPs/indels,--group-identityfor grouping similar variants, and--select-max-variantsfor controlling which variants to output
After initial clustering, Speconsense automatically merges clusters with identical or homopolymer-equivalent consensus sequences:
Default behavior (homopolymer-aware merging):
- Clusters with identical consensus sequences are automatically merged
- Clusters with homopolymer-equivalent sequences are also merged (e.g., "AAA" vs "AAAAA" treated as identical)
- Homopolymer length differences are ignored as they typically represent ONT sequencing artifacts
- This helps eliminate redundant clusters that represent the same biological sequence but differ only in homopolymer lengths
Strict identity merging (--disable-homopolymer-equivalence):
- Only clusters with perfectly identical consensus sequences are merged
- Use this flag when homopolymer differences may have biological significance
- Results in more clusters but ensures no information loss from homopolymer variation
This automatic merging step helps consolidate redundant clusters that were separated during initial clustering. The adjusted identity scoring with homopolymer normalization provides more accurate assessment of sequence similarity for merging decisions, especially for nanopore data where homopolymer length calling can be inconsistent.
Variant merging with IUPAC codes: For more aggressive merging based on SNP and indel thresholds (which creates IUPAC consensus sequences with ambiguity codes), use the --merge-position-count and --merge-indel-length options in speconsense-summarize during post-processing. See the Advanced Post-Processing section.
Speconsense provides two complementary filters to control which clusters are output:
Absolute size filtering (--min-size, default: 3):
- Filters clusters by absolute number of reads
- Applied at the post-phasing size-filtering phase (after merging, phasing, reassignment, recovery, and CER validation)
- Set to 0 to disable and output all clusters regardless of size
Processing order (high level):
- Initial clustering produces raw clusters
- Pre-phasing merge of identical/homopolymer-equivalent clusters
- Variant phasing splits clusters by haplotype
- Post-phasing merge collapses any newly-equivalent subclusters
- Noise filter drops clusters with no-majority MSA columns
- Read reassignment moves reads between clusters within identity groups
- Discard recovery re-admits previously-dropped reads to surviving clusters
- Second phasing pass re-phases any clusters that gained reads
- CER validation annotates each non-anchor cluster with a
cer_factor - Size filtering: apply
--min-size - Final consensus + MAD outlier removal + FASTA writing
Deferred filtering strategy:
For maximum flexibility in detecting rare variants and contaminants, set --min-size 0 in speconsense and apply final quality thresholds in summarize via --min-ric, --min-cer-factor, --max-err-factor, and --prune-group-ratio/--prune-group-count. This lets you run expensive clustering once and experiment with thresholds during post-processing. The CER and err_factor filters route low-confidence clusters to the .ns/.lq track rather than dropping them entirely, so you can revisit decisions without re-running core.
Consensus sequences are generated using SPOA (SIMD Partial Order Alignment) which efficiently handles the error profile of nanopore reads. For larger clusters, a random subset of reads (controlled by --max-sample-size) is used to generate the consensus.
To evaluate the reliability of consensus sequences, Speconsense calculates read identity metrics by:
- Aligning all reads in a cluster to the consensus sequence using SPOA multiple sequence alignment
- Computing per-read identity scores with homopolymer normalization
- Reporting mean read identity (
rid) and minimum read identity (rid_min)
Key metrics:
rid- Mean read identity: The average identity of all reads to the consensus (0-100%). Higher values indicate more homogeneous clusters.rid_min- Minimum read identity: The worst-case read identity. Low values may indicate outliers or mixed clusters.
Homopolymer-normalized identity: Speconsense uses the adjusted-identity algorithm with homopolymer normalization for more accurate sequence comparisons. This means that differences in homopolymer run lengths (e.g., AAA vs AAAAA) are treated as identical, which is particularly important for nanopore sequencing data where homopolymer length calling can be inconsistent. The identity metrics exclude homopolymer length differences, so low rid values indicate true substitutions or structural indels rather than sequencing artifacts.
Automatic variant detection: By default, Speconsense analyzes positional variation within clusters to detect true biological variants vs sequencing errors. Positions where variant alleles exceed the minimum frequency threshold are flagged as variant positions, and reads are automatically separated into distinct haplotypes (see Automatic Variant Phasing).
When a primers file is provided via --primers, Speconsense will identify and trim primer sequences from the 5' and 3' ends of consensus sequences, producing clean amplicon sequences for downstream analysis.
Automatic primer detection: If --primers is not specified, Speconsense will automatically look for primers.fasta in the same directory as the input FASTQ file. If found, primer trimming will be enabled automatically.
By default, Speconsense automatically detects and separates biological variants within clusters. This feature is particularly useful for heterozygous samples or mixed-species amplicons.
How variant phasing works:
-
Variant detection: After initial clustering, Speconsense analyzes positional variation using multiple sequence alignment. A position qualifies as a variant either across the full cluster or within a quality-biased sample of top-quality reads (whichever fires) when the minor allele frequency exceeds the threshold (default 10%) and meets minimum read count requirements.
-
Position selection: When multiple variant positions are detected, Speconsense selects the single best position for splitting (minimizing within-cluster error), then recursively regenerates MSA for each subcluster to discover additional variant positions. This hierarchical approach prevents over-fragmentation while allowing deep phasing when supported by the data.
-
Haplotype separation: Reads are grouped by their allele combinations at selected variant positions. Each unique combination becomes a separate sub-cluster (haplotype). Reads that don't qualify for any haplotype are discarded rather than force-reassigned, and may be recovered later by phase 7.
-
IUPAC ambiguity calling: When only one haplotype qualifies (insufficient support for phasing), variant positions are encoded using IUPAC ambiguity codes (e.g.,
Yfor C/T,Rfor A/G). The same machinery handles "no-majority" columns where phasing produced a single haplotype but multiple alleles still exceed thresholds. Ambiguity calling uses a lower count threshold (3 reads vs 5 for splitting), capturing variation that doesn't have enough support to form a viable separate cluster.
Key parameters for variant phasing:
--min-variant-frequency— Minimum minor allele frequency to trigger cluster splitting (default: 0.10 = 10%)--min-variant-count— Minimum read count for minor allele to trigger splitting (default: 3)--disable-position-phasing— Disable variant phasing entirely (also skips the second phasing pass)--disable-read-reassignment— Disable cross-cluster reassignment within identity groups (phase 6)--disable-discard-recovery— Disable re-admission of previously discarded reads to surviving clusters (phase 7; requires--enable-read-reassignment)
Key parameters for IUPAC ambiguity calling:
--min-ambiguity-frequency— Minimum minor allele frequency for IUPAC codes (default: 0.10 = 10%)--min-ambiguity-count— Minimum read count for minor allele for IUPAC codes (default: 3)--disable-ambiguity-calling— Disable IUPAC codes for unphased variants
Example:
# Default behavior: variant phasing enabled
speconsense input.fastq
# More permissive variant detection (lower frequency threshold)
speconsense input.fastq --min-variant-frequency 0.05
# More aggressive IUPAC ambiguity calling
speconsense input.fastq --min-ambiguity-frequency 0.05 --min-ambiguity-count 2
# Disable variant phasing but keep ambiguity calling
speconsense input.fastq --disable-position-phasing
# Disable both phasing and ambiguity calling
speconsense input.fastq --disable-position-phasing --disable-ambiguity-callingAfter initial clustering, speconsense runs a 12-phase pipeline. Phases 5–9 are the post-phasing refinement work that distinguishes 0.8.x from earlier versions:
| Phase | Name | Purpose |
|---|---|---|
| 1 | Initial clustering | MCL graph-based or greedy |
| 2 | Pre-phasing merge | Combine HP-equivalent initial clusters |
| 3 | Variant phasing | Split clusters by haplotype via MSA position analysis |
| 4 | Post-phasing merge | Combine HP-equivalent subclusters |
| 5 | Noise filter | Drop small clusters with no-majority MSA columns |
| 6 | Read reassignment | Move reads between clusters within an identity group when consensus concordance supports it |
| 7 | Discard recovery | Re-admit previously-dropped reads to surviving clusters |
| 8 | Second phasing pass | Re-phase clusters whose membership changed via reassignment/recovery |
| 9 | CER validation | Annotate each non-anchor cluster with a cer_factor |
| 10 | Size filtering | Apply --min-size |
| 11 | Output generation | Final consensus, MAD outlier removal, FASTA writing |
| 12 | Discard writeout | Optional, with --collect-discards |
Identity groups: phases 6, 7, and 9 operate within identity groups computed via complete linkage at --group-identity (default 0.85). Every pair within a group must meet the threshold, preventing transitive collapse of close-but-distinct variants. Group ranks (gid) and within-group variant ranks (vid) are emitted into the FASTA header and travel through to summarize.
Each non-anchor cluster is annotated with a CER factor (cer_factor=) measuring how implausible it is as basecaller-noise replicates of a larger peer in its identity group. This is a per-position multiplicative inflation of the assumed error rate that would be required for the peer's read counts to plausibly produce the candidate's read counts at the observed disagreement positions, under a binomial test with combinatorial Bonferroni correction over C(L, K) site combinations (where L is the HP-compressed length and K is the number of disagreement sites).
A higher cer_factor means more confidence the candidate is a real variant. Anchors and clusters that fail to find a valid pairwise comparison carry cer_factor=None and always pass filtering.
Context-aware error model: Per-position error rates come from a shipped dorado-v5.0 model (other models can be selected with --error-model NAME, listed via --list-error-models). Each variant event is classified as non-hp-sub, non-hp-indel, or hp-l{N} (HP run of length N) using the reference consensus's HP context (the artifact hypothesis under test is that the candidate's reads are miscalled copies of the reference). HP runs longer than the table's max length route to blanket HP normalization rather than CER evaluation; --hp-normalization-length (default 6) sets the cutoff.
No filtering happens in core — the CER decision is a summarize concern, applied via --min-cer-factor (default 1.0, set to 0 to disable). Records below threshold route to __Summary__/variants/{name}.ns-RiC{ric}.fasta.
Complementary to CER, err_factor is a peer-independent metric: for each non-gap consensus column, the fraction of reads disagreeing with the consensus divided by the q_ctx rate predicted for that column's context (HP run length or non-HP). Values near 1.0 mean reads consistent with basecaller noise; values ≫ 1.0 indicate internal heterogeneity beyond what sequencing noise produces.
Unlike cer_factor, err_factor distinguishes novel-but-real sequences (low err_factor, possibly high cer_factor) from noise combinations (high err_factor regardless of CER).
Filtering happens in summarize via --max-err-factor (default 1.5, set to 0 to disable). Records above threshold route to __Summary__/variants/{name}.lq-RiC{ric}.fasta. The 1.5 default is safe because MAD outlier removal at final consensus removes single-read outliers that would otherwise inflate err_factor on real clusters.
Both cer_factor and err_factor rely on a per-context error model that says "what's the basecaller's error rate at a position with this HP context?" These models live as YAML files keyed by event type:
name: dorado-v5.0
chemistry: R10.4.1
basecaller: Dorado v5.0
source: Re-estimated on ont98 dataset under speconsense 0.8.0
rates:
non-hp-sub: 0.005 # Substitution at a non-HP position
non-hp-indel: 0.010 # Insertion + deletion at a non-HP position
hp-l1: 0.006 # Length change in an HP run of length 1
hp-l2: 0.008
hp-l3: 0.010
hp-l4: 0.011
hp-l5: 0.012Selecting a model:
speconsense input.fastq --error-model dorado-v5.0 # Default
speconsense input.fastq --list-error-models # Show installed models
speconsense input.fastq --error-model /path/to/custom.yaml # Filesystem pathResolution order: filesystem path → ~/.config/speconsense/error_models/ → bundled. Bundled models include dorado-v5.0 (default) and dorado-v3.5.
Creating a custom model:
The easiest way is to fit one from a finished run using speconsense-fit-error-model:
speconsense-fit-error-model /path/to/clusters --name my-basecallerThis walks the run's cluster_debug/ and writes ~/.config/speconsense/error_models/my-basecaller.yaml, then prints a comparison against the model the run was clustered under. See Fitting a Custom Error Model for the full workflow and the underlying procedure (HP paper §8 re-estimation: approach-1 mode-as-ground-truth at qualifying primary anchors + approach-2 all-cluster non-HP pooling, with biological-variant filtering).
Alternatively, drop a YAML file into ~/.config/speconsense/error_models/my-basecaller.yaml by hand with the format above, then select it via --error-model my-basecaller. HP run lengths absent from the model route to blanket HP normalization rather than context-aware CER evaluation, so models can be sparse.
HP normalization length (--hp-normalization-length, default 6):
- HP runs of length ≥ this value are blanket-normalized in distance/MSA comparisons (treated as noise)
- HP runs shorter than this are surfaced as candidates and evaluated by context-aware CER (using
hp-l1...hp-l5from the model) - Set to 1 for legacy blanket-normalize-all behavior; matches the HP error rate paper's recommendation of CER-evaluating L≤5 HP variants
When to use variant phasing (default):
- Heterozygous specimens where you want to separate alleles
- Samples with potential mixed-species amplification
- Quality control to identify clusters with internal heterogeneity
When to disable variant phasing:
- Homozygous samples where variation indicates sequencing errors only
- When you prefer merged IUPAC consensus over separate haplotypes
- For faster processing when variant separation is not needed
The speconsense-summarize tool provides sophisticated options for managing multiple variants per specimen. This section covers advanced variant handling - for basic usage, see the Usage section above.
Identity groups are computed once, in core, via complete linkage at --group-identity (default 0.85). speconsense-summarize honors those groups via the gid=/vid= headers and does not re-cluster. Within each group, summarize applies MSA-based variant merging and selection.
Output naming round-trips core's gid.vid for every variant unless cross-primer overlap conflation moved that variant into a different group. Filtered-out or merged-away variants leave their vids as gaps under the surviving gid. Moved variants adopt the survivor group's gid and receive a freshly-minted vid above the highest vid core wrote under that gid (across passed, .ns, and .lq records); the allocator handles 2+ group conflation without collisions.
Group identity (cross-primer overlap merging only):
speconsense-summarize --group-identity 0.85- Used by summarize only for cross-primer overlap merging — bridging two core groups whose anchors overlap above the identity threshold (e.g., ITS and ITS2 amplicons of the same biological entity)
- Default
0.85matches core's--group-identityso cross-primer pairs use the same anchor distance as core's complete-linkage groups - For raising/lowering core's grouping aggressiveness, set
--group-identityonspeconsenseitself, then re-run summarize
Variant Selection (within each group):
When multiple variants exist per identity group, speconsense-summarize selects variants by size (largest first). Use --select-max-variants N to cap the number of variants per group (default: no limit).
Overall Process:
- Read FASTA outputs from
speconsense, parsinggid=/vid=to recover core's identity groups - Cross-primer overlap merger across groups (matches different-primer anchors that overlap above
--group-identity) - For each (possibly conflated) group independently:
- Apply MSA-based merging to find largest compatible subsets
- Apply selection size ratio filtering (
--select-min-size-ratio) - Apply variant selection strategy (size or diversity)
- Output up to
select_max_variantsper group
- Apply CER filter (
--min-cer-factor) — route failing records to.ns - Apply err_factor filter (
--max-err-factor) — route failing records to.lq(.lqtakes precedence over.nsif both fire) - Final output contains representatives from all groups; filtered records remain accessible under
__Summary__/variants/
Selection Size Ratio Filtering:
speconsense-summarize --select-min-size-ratio 0.2- Filters out post-merge variants whose size is too small relative to the group total
- Ratio calculated as
variant_size / group_total— must be ≥ threshold to keep - The largest variant in each group is always kept
- Example:
--select-min-size-ratio 0.2means a variant must represent ≥20% of the group's total reads - Default is 0 (disabled) — all post-merge variants pass through to selection
- Applied after merging but before variant selection
- Useful for suppressing noise variants that survived merging but are too small to be meaningful
- Set to 0.2 in the
compressedprofile to match the 20% calling threshold theme
This two-stage process ensures that distinct biological sequences are preserved as separate groups, while providing control over variant complexity within each group.
Group "full" Consensus (query-optimized):
speconsense-summarize --enable-full-consensus- Per identity group with ≥2 selected variants on the pass track, emit an additional
-{gid}-fullconsensus alongside the phased variants - Built from a size-weighted, top-mean-Phred read sample (budget = core's
--max-sample-size, default 100) drawn across the pre-merge core variants whose size clears the running-total gate at--min-ambiguity-frequency(also inherited from the core run, default 0.10) - SPOA with linear gap scoring; local alignment (
-l 0) for cross-primer-conflated groups, global (-l 1) otherwise - Consensus uses one-vote-per-read, majority-wins gaps, and IUPAC ambiguity codes at columns where ≥2 bases each clear
--min-ambiguity-frequency - Suppressed when fewer than 2 pass-track variants exist or fewer than 2 contributors clear the gate;
.ns/.lqrecords are not eligible to contribute - Intended use: BLAST query against legacy unphased ITS references. The
-fulloutput is IUPAC-bearing by construction and should be scored with adjusted-identity (MycoBLAST) tools — under raw BLAST it will silently degrade because every IUPAC code counts as a mismatch - Enabled by default in the
compressedprofile
Consensus Column Retention (gap handling):
speconsense-summarize --min-position-frequency 0.1 --min-position-count 3- Controls how gap vs. base disagreements are resolved in merged and
-fullconsensus sequences - A column is retained when the fraction of non-gap content is ≥
--min-position-frequencyAND the absolute non-gap support is ≥--min-position-count - Default
0.5matches majority-wins behavior: positions where more than half the (size-weighted) votes are gaps are omitted - Lower values (e.g.
0.1) preserve positions where a minority of contributors carry content — useful when merging variants of different lengths or when indel events should not delete content from the merged consensus --min-position-count(default 3) prevents columns with negligible support from surviving at low frequency thresholds- Set to
0.1in thecompressedprofile alongside its aggressive merge settings - Applies to within-group MSA merging, overlap merging (overlap region only — non-overlap regions always preserve content from contributing sequences), and
-fullgroup consensus
Control which metadata fields appear in FASTA headers using the --fasta-fields option:
Presets:
# Default preset (current behavior)
speconsense-summarize --fasta-fields default
# Output: >sample-1 size=638 ric=638 rawric=333+305 snp=1 ambig=1 primers=5'-ITS1F,3'-ITS4_RC
# Minimal headers - just the essentials
speconsense-summarize --fasta-fields minimal
# Output: >sample-1 size=638 ric=638
# QC preset - includes read identity and length
speconsense-summarize --fasta-fields qc
# Output: >sample-1 size=638 ric=638 length=589 rid=98.5 ambig=1
# Full metadata (all available fields)
speconsense-summarize --fasta-fields full
# Output: >sample-1 size=638 ric=638 length=589 rawric=333+305 snp=1 ambig=1 rid=98.5 primers=...
# ID only (no metadata)
speconsense-summarize --fasta-fields id-only
# Output: >sample-1Custom field selection:
# Specify individual fields (comma-separated)
speconsense-summarize --fasta-fields size,ric,primers
# Combine presets and fields
speconsense-summarize --fasta-fields minimal,rid
# Combine multiple presets
speconsense-summarize --fasta-fields minimal,qcAvailable fields:
size— Total reads across merged variantsric— Reads in consensuslength— Sequence length in basesrawric— RiC values of.rawsource variants (only when merged)rawlen— Original sequence lengths before overlap merging (only when overlap-merged)snp— Number of IUPAC positions from merging (only when >0)ambig— Count of IUPAC ambiguity codes in consensusrid— Mean read identity percentage (when available)rid_min— Minimum read identity percentage (when available)cer_factor— Statistical variant validation factor (None for anchors)err_factor— Cluster homogeneity ratio (observed/expected disagreement)primers— Detected primer names (when detected)locus— Detected locus label:ITS,ITS1, orITS2(requires pyitsx + ITSx; auto-enabled when pyitsx is available)group— Identity group number (extracted from-{gid}.v{vid}filename; superseded bygid=from core)variant— Variant identifier within group (extracted from filename; superseded byvid=from core)
Preset definitions:
default:size, ric, rawric, rawlen, snp, ambig, primersminimal:size, ricqc:size, ric, length, rid, ambig, cer_factor, err_factorfull:size, ric, length, rawric, rawlen, snp, ambig, rid, cer_factor, err_factor, primers, locusid-only: (no fields)
The default preset does not include cer_factor / err_factor / gid / vid. If you want CER and homogeneity metrics in summarize-emitted FASTAs, use --fasta-fields qc or --fasta-fields full. Core's own FASTA always includes gid, vid, cer_factor, and err_factor regardless of the summarize preset.
Use cases:
- Downstream tool compatibility: Use
minimalorid-onlyfor tools expecting simple headers - Quality control: Use
qcpreset to include read identity metrics for assessing consensus quality - File size optimization: Use
minimalto reduce file size for large datasets - Custom workflows: Combine presets and fields for workflow-specific needs
Speconsense-summarize automatically generates a quality_report.txt to help prioritize manual review of sequences with potential quality concerns. The report is inspection-oriented — it highlights specimens and variants that warrant a closer look, rather than dumping descriptive statistics.
Report Generation:
- Created automatically in the summary output directory
- No configuration required — generated regardless of
--fasta-fieldssettings - Focuses on actionable issues, not exhaustive enumeration
Report Sections:
1. Executive Summary:
- Pass/
.ns/.lqcounts across the run - Specimens that had input reads but produced no clusters (often a demultiplexing or input-quality signal)
- Filter decisions from
--min-cer-factorand--max-err-factor
2. Passed Variants Worth Inspecting:
- Run-relative outliers on
err_factorand ambiguity count (mean ± 2σ) - Variants that passed filters but stand out from the rest of the run
3. Possible Rescues:
- Low-yield specimens whose filtered (
.ns/.lq) variants are close to the threshold - Suggests manual review of variants that might warrant a relaxed threshold for that specimen
4. Overlap Merge Details (when present):
- Lists cross-primer overlap merges, with overlap bp and prefix/suffix extensions
- Flags edge cases (overlap near threshold, large length ratios)
5. Run-Wide Parameter Signals:
- Suggests parameter tuning when a metric is systematically high or low across the run
6. Pipeline Activity:
- Phase-by-phase activity counts (clusters disbanded, reads reassigned, reads recovered, second-pass splits, CER-filtered, err_factor-filtered) aggregated across specimens
- Helps surface unexpected pipeline behavior on a new dataset
Recommended Actions:
For high err_factor outliers:
- The cluster's reads disagree with the consensus more than the basecaller's noise model predicts
- Review
cluster_debug/FASTQ files in source directory - Check for biological heterogeneity (multiple true variants in one cluster) — if so, consider lowering
--min-variant-frequencyor--min-variant-countand re-running core - May indicate cross-specimen contamination if the disagreement pattern aligns with another specimen
For high ambiguity count outliers:
- Review whether ambiguity represents true heterozygosity, merging artifact, or unphased variation
- Check if variant phasing would produce cleaner separate haplotypes (lower
--min-variant-frequency) - Cross-reference with
__Summary__/trees/{specimen}.txtto see the variant hierarchy
For .ns records (failed CER):
- The cluster is statistically explained as basecaller noise replicated from a larger peer
- Most are correctly filtered. To rescue: lower
--min-cer-factor(default1.0;0.5is a common relaxation) and re-run summarize
For .lq records (failed err_factor):
- The cluster's internal heterogeneity exceeds the basecaller noise model
- Consider whether the cluster is real but degraded (herbarium samples often inflate
err_factor) — theherbariumprofile disables this filter
Quality Filtering:
speconsense-summarize --min-ric 5- Filters out consensus sequences with fewer than the specified number of Reads in Consensus (RiC)
- Default is 3 — only sequences supported by at least 3 reads are processed
- Higher values provide more stringent quality control but may exclude valid low-abundance variants
CER Filtering (statistical variant validation):
speconsense-summarize --min-cer-factor 1.0 # Default
speconsense-summarize --min-cer-factor 0.5 # More permissive
speconsense-summarize --min-cer-factor 0 # Disable--min-cer-factor: Minimum per-position CER factor for a variant to be kept on the primary track (default:1.0)- Variants with
cer_factorbelow threshold route to__Summary__/variants/{name}.ns-RiC{ric}.fasta(and matching FASTQ) — they are not deleted, just sidelined cer_factor=None(anchors and clusters without a valid pairwise comparison) always passes- See Statistical Variant Validation (CER) for the underlying model
Cluster Homogeneity Filtering (err_factor):
speconsense-summarize --max-err-factor 1.5 # Default
speconsense-summarize --max-err-factor 2.0 # More permissive (e.g., for herbarium specimens)
speconsense-summarize --max-err-factor 0 # Disable--max-err-factor: Maximum clustererr_factor(observed/q_ctx-expected disagreement) for primary-track inclusion (default:1.5)- Variants above threshold route to
__Summary__/variants/{name}.lq-RiC{ric}.fasta .lqtakes precedence over.nswhen both fire — a cluster filtered by both labels appears only as.lq- See Cluster Homogeneity (err_factor) for the underlying metric
Length Filtering:
speconsense-summarize --min-len 400 --max-len 800--min-len: Minimum sequence length in bp (default: 0 = disabled)--max-len: Maximum sequence length in bp (default: 0 = disabled)- Applied during initial sequence loading
- Useful for filtering incomplete amplicons or chimeric sequences
Variant Merging:
# Basic SNP-only merging (default)
speconsense-summarize --merge-position-count 2
# Enable indel merging (up to 3bp indels)
speconsense-summarize --merge-position-count 3 --merge-indel-length 3
# Disable SNP merging (only merge identical sequences)
speconsense-summarize --merge-snp false
# Disable all merging (fastest, skip MSA evaluation entirely)
speconsense-summarize --disable-merging
# Control merge evaluation effort (performance vs thoroughness)
speconsense-summarize --merge-effort fast # Faster, may miss some merges in large groups
speconsense-summarize --merge-effort balanced # Default
speconsense-summarize --merge-effort thorough # More exhaustive for large variant groups
# Legacy parameter (still supported)
speconsense-summarize --snp-merge-limit 2 # Equivalent to --merge-position-count 2- Occurs within each HAC group - merges variants that differ by small numbers of SNPs and/or indels
- Uses MSA-based approach with SPOA: evaluates all possible subsets to find the largest compatible group for merging
- Creates IUPAC consensus sequences with size-weighted majority voting at polymorphic positions
- Order-independent: produces identical results regardless of input order (unlike pairwise greedy approaches)
- Only merges variants with identical primer sets to maintain biological validity
Merge Parameters:
--disable-merging: Skip MSA-based merge evaluation entirely (fastest option when merging is not needed)--merge-effort LEVEL: Control merge evaluation thoroughness. Presets:fast(8),balanced(10, default),thorough(12), or numeric 6-14. Higher values use larger batch sizes for exhaustive subset search, improving merge quality for large variant groups at the cost of runtime--merge-position-count N: Maximum total SNP + structural indel positions allowed (default: 2)--merge-indel-length N: Maximum length of individual structural indels allowed (default: 0 = disabled)--merge-snp: Enable/disable SNP merging (default: True)--merge-min-size-ratio R: Minimum size ratio (contributor/merged total) for merging clusters (default: 0.1, 0 to disable)--disable-homopolymer-equivalence: Treat homopolymer length differences as structural indels (default: disabled, meaning homopolymer equivalence is enabled)--snp-merge-limit N: Legacy parameter, equivalent to--merge-position-count(deprecated)
Homopolymer-Aware Merging (Default Behavior):
By default, speconsense-summarize uses homopolymer-aware merging that distinguishes between structural indels (true insertions/deletions) and homopolymer length differences (e.g., AAA vs AAAA). This matches the semantics of adjusted-identity alignment used throughout the pipeline.
How it works:
- Analyzes SPOA multiple sequence alignment to classify each indel column
- Homopolymer indel: All non-gap bases are the same, and all sequences agree on that base in adjacent columns
- Example:
ATA-AAGCvsATAAAAGC→ homopolymer (all have A's flanking the gap)
- Example:
- Structural indel: True insertion/deletion, or indel adjacent to SNP
- Example:
CTAA-GCvsCTG-AGC→ structural (A vs G flanking the gap)
- Example:
- Homopolymer indels are ignored when checking merge compatibility (treated as equivalent)
- Structural indels count against
--merge-position-countand--merge-indel-lengthlimits
Default behavior examples:
- Sequences differing only by homopolymer length (AAA vs AAAA): Merge ✓
- Sequences with 2 SNPs + 5 homopolymer indels: Merge ✓ (only SNPs count)
- Sequences with 1 structural indel: Blocked (default
--merge-indel-length=0)
Strict identity merging (--disable-homopolymer-equivalence):
speconsense-summarize --disable-homopolymer-equivalence- Treats homopolymer length differences as structural indels
- All indels (both homopolymer and structural) count against merge limits
- Only sequences identical (or differing by SNPs if
--merge-snpenabled) can merge - Use when you want to preserve homopolymer length variation as distinct variants
Example comparison:
# Default (homopolymer equivalence enabled)
# Variants: ATAAAGC (3 A's) vs ATAAAAGC (4 A's)
speconsense-summarize
# Result: Merge ✓ (homopolymer difference ignored)
# Strict mode (homopolymer equivalence disabled)
speconsense-summarize --disable-homopolymer-equivalence
# Result: Do not merge (treated as structural indel)Position counting examples:
With default settings (--merge-position-count 2 --merge-indel-length 0):
- 2 SNPs + 0 structural indels + 10 homopolymer indels ✓ (only structural counted)
- 0 SNPs + 1 structural indel + 5 homopolymer indels ✗ (structural indel blocked)
- 1 SNP + 1 structural indel (≤2bp) ✗ (indel blocked by length limit)
With indels enabled (--merge-position-count 3 --merge-indel-length 2):
- 3 SNPs + 0 structural indels + any homopolymer indels ✓
- 2 SNPs + 1 structural indel (≤2bp) + any homopolymer indels ✓
- 0 SNPs + 3 structural indels (each ≤2bp) + any homopolymer indels ✓
- 2 SNPs + 2 structural indels (each ≤2bp) ✗ (total=4 > 3)
- 2 SNPs + 1 structural indel (3bp) ✗ (indel too long)
Merged consensus tracking:
- Merged sequences include
rawricheader field showing RiC values of merged .raw variants - Example:
>sample-1 size=250 ric=250 rawric=100+89+61 snp=2 - Helps trace which original clusters contributed to merged consensus
Note: Homopolymer-aware merging in speconsense-summarize complements the automatic homopolymer-equivalent cluster merging that occurs during the main clustering step in speconsense
Understanding MSA-Based Merge Evaluation:
A key architectural feature of speconsense-summarize is that all sequences within a HAC group are aligned together by SPOA first, creating a single multi-sequence alignment (MSA) that provides biological and evolutionary context for all subsequent merge decisions within that group.
Why this matters:
When evaluating whether two sequences can merge, the algorithm doesn't perform a simple pairwise alignment. Instead, it examines how those sequences align within the context of all other sequences in their HAC group. This shared alignment context can reveal that apparent structural differences are actually homopolymer length variations relative to the majority pattern.
Example:
Consider two sequences (c4 and c9) from the same HAC group. When aligned in isolation, they appear incompatible:
Pairwise alignment (c4 vs c9 only):
c4: ..504..GTAAATT..242..AG
c9: ..504..G-GTACT..242..AA
This pairwise alignment shows 4 SNPs + 1 structural indel, making them incompatible for merging with default parameters.
However, when aligned with all sequences in their HAC group, a different picture emerges:
Multi-sequence alignment (c1, c2, c4, c5, c7, c8, c9):
c1: ..153..AAA..57..AGC..151..CTCTT..131..A-GTAAATT.TCA..213..TCAG..21..AA
c2: ..153..ATA..57..AAC..151..CTCTT..131..A-GTAAATT.TCA..213..TCAG..21..AA
c4: ..153..AAA..57..AGC..151..CTCTT..131..A-GTAAATT.TCA..213..TCAG..21..AG
c5: ..153..AAA..57..AGC..151..C---T..131..A-GTAAATT.TCA..213..TCAG..21..AA
c7: ..153..AAA..57..AGC..151..CTCTT..131..A-GT-ACTT.T-A..213..TCAG..21..AA
c8: ..153..AAA..57..AGC..151..CTCTT..131..A-GTAAATT.TCA..213..TAGG..21..AA
c9: ..153..AAA..57..AGC..151..CTCTT..131..AGGT-AC-T.TCA..213..TCAG..21..AA
In this multi-sequence context, the majority pattern (seen in c1, c2, c4, c5, c8) is A-GTAAATT in the critical region around position 131. The c9 sequence (AGGT-AC-T) differs from c4, but the gaps occur at different positions in the homopolymer-rich region. The multi-sequence alignment reveals that c9's differences are better explained as homopolymer length variations (extra G's and different gap placements in poly-A and poly-T regions) rather than true structural changes. This results in only 2 SNPs + 3 homopolymer indels, making them compatible for merging.
This biological interpretation, informed by the evolutionary context of multiple related sequences, produces more accurate merge decisions than pairwise comparisons alone.
Practical implication:
Merge decisions depend on the complete HAC group composition, not just the sequences being evaluated. Two sequences that appear incompatible in isolation may merge when analyzed in their full biological context, and vice versa. This is by design—the multi-sequence context provides more accurate biological interpretation of sequence variation.
Merge Size Ratio Filtering:
speconsense-summarize --merge-min-size-ratio 0.1- Prevents merging clusters with very different sizes (e.g., well-supported variant + poorly-supported variant)
- For each candidate merge subset, every contributor must be ≥ threshold fraction of the subset total
- Example:
--merge-min-size-ratio 0.1means every contributor must represent ≥10% of the merged total - Default is 0.1
- Use cases:
- Prevent poorly-supported variants (low read count) from introducing ambiguities into well-supported sequences
- Avoid merging weakly-supported bioinformatic artifacts into high-confidence sequences
- Applied during MSA-based merging step, within each HAC group
Group Output Limiting:
speconsense-summarize --select-max-groups 2- Limits output to top N groups per specimen (by size of largest member in each group)
- Default is -1 (output all groups)
- Applied after HAC clustering but before MSA-based merging and variant selection
- Useful for focusing on primary specimens and ignoring small contaminant groups
- Example:
--select-max-groups=1outputs only the largest variant group per specimen
Directory Control:
speconsense-summarize --source /path/to/speconsense/output --summary-dir MyResults--source: Directory containing speconsense output files (default: clusters)--summary-dir: Output directory name (default:__Summary__)
When using multiple primers targeting the same locus ("primer pools"), reads may have overlapping but different coverage. The overlap merge feature (enabled by default) allows merging such sequences when they share sufficient overlap.
How it works:
- During HAC clustering, uses single-linkage to group overlapping sequences
- Identifies sequences with sufficient overlap meeting identity threshold
- Creates consensus from union of coverage (overlap region uses majority voting)
- Supports iterative merging for 3+ overlapping sequences
- Primer-constrained: Overlap-aware distance only applies when sequences have different primer pairs (legitimate primer pool scenarios). Same-primer sequences use global distance to prevent chimeras from incorrectly merging with shorter amplicons.
Parameters:
--min-merge-overlap N: Minimum overlap in bp (default: 200, 0 to disable)--group-identity: Identity threshold for HAC grouping, also used for overlap region identity (default: 0.9)
Example:
# Default behavior (overlap merging enabled)
speconsense-summarize --source clusters
# Disable overlap merging (original behavior)
speconsense-summarize --source clusters --min-merge-overlap 0
# More permissive overlap (allow smaller overlaps)
speconsense-summarize --source clusters --min-merge-overlap 100Use cases:
- ITS2 sequence merging with full ITS sequence
- Overlapping amplicons from primer pools
- Partial sequences merging with complete references
Output indicators:
- Log messages show
(overlap=Xbp, prefix=Ybp, suffix=Zbp)for overlap merges - FASTA headers include
rawlen=X+Yshowing original sequence lengths - Quality report includes "OVERLAP MERGE ANALYSIS" section with details on partial overlaps
Containment handling:
When a shorter sequence is fully contained within a longer one (e.g., ITS2 within full ITS), the merge is allowed if overlap >= min(threshold, shorter_length).
The complete speconsense-summarize workflow operates in this order:
- Load sequences with RiC filtering (
--min-ric) and length filtering (--min-len,--max-len); parsegid=/vid=from FASTA headers (hard-fails if missing) - Bucket by core-assigned identity group — no re-grouping
- Cross-primer overlap conflation (
--min-merge-overlap,--group-identity) merges different-primer core groups whose anchors overlap above the identity threshold - Homopolymer-aware MSA-based variant merging within each (possibly-conflated) group (
--disable-merging,--merge-effort,--merge-position-count,--merge-indel-length,--min-merge-overlap,--merge-snp,--merge-min-size-ratio,--disable-homopolymer-equivalence,--hp-normalization-length) - Selection size ratio filtering to remove tiny post-merge variants (
--select-min-size-ratio) - Variant selection within each group (
--select-max-variants,--select-max-groups) - CER and err_factor filtering — route failing records to
.ns/.lq(--min-cer-factor,--max-err-factor) - Output generation — passing FASTA + FASTQ, filtered records under
variants/, per-specimen tree undertrees/, customizable header fields (--fasta-fields) and full traceability
Key architectural features:
- Identity grouping happens once, in core, via complete-linkage HAC at
--group-identity(default 0.85). Summarize honors that grouping viagid/vidheaders — no independent HAC pass - Cross-primer overlap conflation is the only operation that crosses core-group boundaries, gated by anchor identity AND sufficient sequence overlap
- Merging is applied independently within each (possibly-conflated) group using MSA-based consensus generation
- Homopolymer-aware merging by default (AAA ≈ AAAA, runs ≥
--hp-normalization-lengthblanket-normalized) to match pipeline-wide adjusted-identity semantics - CER and err_factor filtering routes records rather than deleting them —
.ns/.lqfiles preserve the data for review and threshold tuning
Speconsense-summarize provides comprehensive logging to help users understand processing decisions:
Variant Analysis Logging:
- Complete variant summaries for every variant in each group, including those that are skipped
- Detailed difference categorization: substitutions, single-nt indels, short (≤3nt) indels, and long indels
- IUPAC-aware comparisons: treats ambiguity codes as matches (e.g., R matches A or G)
- Homopolymer-aware merge reporting: distinguishes structural indels from homopolymer indels
- Group context: clearly shows which variants belong to each HAC clustering group
- Selection rationale: explains why variants were included or excluded
Example log output:
HAC clustering created 2 groups
Group 1: ['sample-c3']
Group 2: ['sample-c1', 'sample-c2']
Found mergeable subset of 2 variants: 2 SNPs, 1 homopolymer indels
Processing Variants in Group 2
Primary: sample-c1 (size=403, ric=403)
Variant 1: (size=269, ric=269) - 1 short (<= 3nt) indel
Variant 2: (size=180, ric=180) - 3 substitutions, 1 single-nt indel - skipping
Traceability Features:
- Merge history: tracks which original clusters were combined during variant merging
- File lineage: maintains connection between final outputs and original speconsense clusters
- Read aggregation:
FASTQ Files/directory contains all reads that contributed to each final consensus - Pre-merge preservation:
variants/directory contains.rawfiles that preserve individual pre-merge variants with their original sequences and reads - Cluster boundaries in merged FASTQ: When multiple clusters are merged, synthetic delimiter records mark boundaries between clusters for easy identification in sequence viewers (e.g., UGENE). Format:
@CLUSTER_BOUNDARY_{n}:{cluster}:RiC={ric}:reads={count}
This comprehensive logging allows users to understand exactly how the pipeline processed their data and make informed decisions about parameter tuning.
usage: speconsense [-h] [-O OUTPUT_DIR] [--primers PRIMERS]
[--algorithm {graph,greedy}] [--min-identity MIN_IDENTITY]
[--inflation INFLATION]
[--k-nearest-neighbors K_NEAREST_NEIGHBORS]
[--min-size MIN_SIZE]
[--max-sample-size MAX_SAMPLE_SIZE]
[--disable-position-phasing] [--enable-position-phasing]
[--disable-read-reassignment] [--enable-read-reassignment]
[--disable-discard-recovery] [--enable-discard-recovery]
[--min-variant-frequency MIN_VARIANT_FREQUENCY]
[--min-variant-count MIN_VARIANT_COUNT]
[--significance-level SIGNIFICANCE_LEVEL]
[--group-identity GROUP_IDENTITY]
[--hp-normalization-length HP_NORMALIZATION_LENGTH]
[--error-model ERROR_MODEL]
[--disable-ambiguity-calling] [--enable-ambiguity-calling]
[--min-ambiguity-frequency MIN_AMBIGUITY_FREQUENCY]
[--min-ambiguity-count MIN_AMBIGUITY_COUNT]
[--disable-cluster-merging] [--enable-cluster-merging]
[--disable-homopolymer-equivalence]
[--enable-homopolymer-equivalence]
[--orient-mode {none,primer,pyitsx}]
[--pyitsx-organism PYITSX_ORGANISM]
[--presample PRESAMPLE] [--scale-threshold SCALE_THRESHOLD]
[--threads N] [--collect-discards]
[--no-collect-discards]
[--log-level {DEBUG,INFO,WARNING,ERROR,CRITICAL}]
[--version] [-p NAME] [--list-profiles]
[--list-error-models]
input_file
MCL-based clustering of nanopore amplicon reads
options:
-h, --help show this help message and exit
--version Show program's version number and exit
-p NAME, --profile NAME
Load parameter profile (use --list-profiles to see
available)
--list-profiles List available profiles and exit
--list-error-models List available error models and exit
Input/Output:
input_file Input FASTQ file
-O OUTPUT_DIR, --output-dir OUTPUT_DIR
Output directory for all files (default: clusters)
--primers PRIMERS FASTA file containing primer sequences (default: looks
for primers.fasta in input file directory)
Clustering:
--algorithm {graph,greedy}
Clustering algorithm to use (default: graph)
--min-identity MIN_IDENTITY
Minimum sequence identity threshold for clustering
(default: 0.9)
--inflation INFLATION
MCL inflation parameter (default: 4.0)
--k-nearest-neighbors K_NEAREST_NEIGHBORS
Number of nearest neighbors for graph construction
(default: 5)
Filtering:
--min-size MIN_SIZE Minimum cluster size (default: 3, 0 to disable)
--max-sample-size MAX_SAMPLE_SIZE
Maximum cluster size for consensus (default: 100)
Variant Phasing:
--disable-position-phasing
Disable position-based variant phasing (enabled by
default). MCL graph clustering already separates most
variants; this second pass analyzes MSA positions to
phase remaining variants.
--enable-position-phasing
Override --disable-position-phasing or profile setting
--disable-read-reassignment
Disable post-phasing read reassignment within identity
groups. Reassignment moves reads between clusters
based on consensus concordance; disable to preserve
original phasing-time membership.
--enable-read-reassignment
Override --disable-read-reassignment or profile
setting
--disable-discard-recovery
Disable recovery of previously discarded reads into
existing clusters. Has no effect if
--disable-read-reassignment is also set (recovery
requires reassignment).
--enable-discard-recovery
Override --disable-discard-recovery or profile
setting
--min-variant-frequency MIN_VARIANT_FREQUENCY
Minimum alternative allele frequency to call variant
(default: 0.10 for 10%)
--min-variant-count MIN_VARIANT_COUNT
Minimum alternative allele read count to call variant
(default: 3)
--significance-level SIGNIFICANCE_LEVEL
Significance level (alpha) for variant significance
testing (default: 1e-5)
--group-identity GROUP_IDENTITY
Minimum pairwise identity to group clusters for read
reassignment, discard recovery, and CER validation.
Grouping uses complete linkage: every pair within a
group must meet this threshold. (default: 0.85)
--hp-normalization-length HP_NORMALIZATION_LENGTH
Minimum homopolymer run length at/above which HP
length variants are blanket-normalized (treated as
noise). Runs of length >= this value have their
length variants suppressed in MSA variant detection;
runs shorter than this surface as candidates and are
evaluated by context-aware CER. Default 6 matches
the HP paper recommendation of CER-evaluating
L <= 5 HP variants. (default: 6)
--error-model ERROR_MODEL
Per-basecaller error model used for context-aware
variant validation. Either a shipped model name (use
--list-error-models to see available), a user model in
~/.config/speconsense/error_models/, or a filesystem
path to a YAML file with a 'rates' mapping. (default:
dorado-v5.0)
Ambiguity Calling:
--disable-ambiguity-calling
Disable IUPAC ambiguity code calling for unphased
variant positions
--enable-ambiguity-calling
Override --disable-ambiguity-calling or profile
setting
--min-ambiguity-frequency MIN_AMBIGUITY_FREQUENCY
Minimum alternative allele frequency for IUPAC
ambiguity calling (default: 0.10 for 10%)
--min-ambiguity-count MIN_AMBIGUITY_COUNT
Minimum alternative allele read count for IUPAC
ambiguity calling (default: 3)
Cluster Merging:
--disable-cluster-merging
Disable merging of clusters with identical consensus
sequences
--enable-cluster-merging
Override --disable-cluster-merging or profile setting
--disable-homopolymer-equivalence
Disable homopolymer equivalence in cluster merging
(only merge identical sequences)
--enable-homopolymer-equivalence
Override --disable-homopolymer-equivalence or profile
setting
Orientation:
--orient-mode {none,primer,pyitsx}
Sequence orientation mode: none (default, no
orientation), primer (orient via primer matching,
discard failed), or pyitsx (orient via ITS HMM
profiles, discard failed/chimeric; requires pyitsx +
ITSx)
--pyitsx-organism PYITSX_ORGANISM
Organism group for pyitsx (default: F for Fungi).
Used for --orient-mode=pyitsx orientation and locus
labeling in summarize. Common codes: F (Fungi),
T (Tracheophyta), M (Metazoa)
Performance:
--presample PRESAMPLE
Presample size for initial reads (default: 1000, 0 to
disable)
--scale-threshold SCALE_THRESHOLD
Sequence count threshold for scalable mode (requires
vsearch). Set to 0 to disable. Default: 1001
--threads N Max threads for internal parallelism (vsearch, SPOA).
0=auto-detect, default=1 (safe for parallel
workflows).
Debugging:
--collect-discards Write discarded reads (outliers and filtered clusters)
to cluster_debug/{sample}-discards.fastq
--no-collect-discards
Override --collect-discards or profile setting
--log-level {DEBUG,INFO,WARNING,ERROR,CRITICAL}
usage: speconsense-summarize [-h] [--source SOURCE]
[--summary-dir SUMMARY_DIR] [--specimen SPECIMEN]
[--aggregate-only] [--fasta-fields FASTA_FIELDS]
[--min-ric MIN_RIC] [--min-len MIN_LEN]
[--max-len MAX_LEN]
[--min-cer-factor MIN_CER_FACTOR]
[--max-err-factor MAX_ERR_FACTOR]
[--group-identity GROUP_IDENTITY]
[--disable-merging] [--enable-merging]
[--merge-snp | --no-merge-snp]
[--merge-indel-length MERGE_INDEL_LENGTH]
[--merge-position-count MERGE_POSITION_COUNT]
[--merge-min-size-ratio MERGE_MIN_SIZE_RATIO]
[--min-merge-overlap MIN_MERGE_OVERLAP]
[--disable-homopolymer-equivalence]
[--enable-homopolymer-equivalence]
[--merge-effort LEVEL]
[--hp-normalization-length HP_NORMALIZATION_LENGTH]
[--select-max-groups SELECT_MAX_GROUPS]
[--select-max-variants SELECT_MAX_VARIANTS]
[--select-min-size-ratio SELECT_MIN_SIZE_RATIO]
[--min-position-frequency MIN_POSITION_FREQUENCY]
[--min-position-count MIN_POSITION_COUNT]
[--scale-threshold SCALE_THRESHOLD] [--threads N]
[--log-level {DEBUG,INFO,WARNING,ERROR,CRITICAL}]
[--version] [-p NAME] [--list-profiles]
Process Speconsense output with advanced variant handling.
options:
-h, --help show this help message and exit
--log-level {DEBUG,INFO,WARNING,ERROR,CRITICAL}
Logging level
--version Show program's version number and exit
-p NAME, --profile NAME
Load parameter profile (use --list-profiles to see
available)
--list-profiles List available profiles and exit
Input/Output:
--source SOURCE Source directory containing Speconsense output
(default: clusters)
--summary-dir SUMMARY_DIR
Output directory for summary files (default:
__Summary__)
--specimen SPECIMEN Process only this specimen. Loads only
<specimen>-all.fasta from --source.
--aggregate-only Skip processing. Generate aggregate summary from
existing per-specimen outputs.
--fasta-fields FASTA_FIELDS
FASTA header fields to output. Can be: (1) a preset
name (default, minimal, qc, full, id-only), (2) comma-
separated field names (size, ric, length, rawric, snp,
rid, rid_min, primers, group, variant), or (3) a
combination of presets and fields (e.g., minimal,qc or
minimal,rid). Duplicates removed, order preserved left
to right. Default: default
Filtering:
--min-ric MIN_RIC Minimum Reads in Consensus (RiC) threshold (default:
3)
--min-len MIN_LEN Minimum sequence length in bp (default: 0 = disabled)
--max-len MAX_LEN Maximum sequence length in bp (default: 0 = disabled)
--min-cer-factor MIN_CER_FACTOR
Minimum per-position CER factor for a variant to be
kept as a primary output. Variants with cer_factor
below this are routed to __Summary__/variants/ as .ns
records. Variants with cer_factor=None (anchors,
clusters without a valid pairwise comparison) always
pass. Set to 0 to disable CER filtering. (default:
1.0)
--max-err-factor MAX_ERR_FACTOR
Maximum cluster err_factor (observed/q_ctx-expected
disagreement ratio). Clusters above this threshold are
routed to __Summary__/variants/ as .lq records.
Variants with err_factor=None (legacy output) always
pass. Set to 0 to disable err_factor filtering.
(default: 1.5)
Grouping:
--group-identity GROUP_IDENTITY, --variant-group-identity GROUP_IDENTITY
Anchor-to-anchor identity threshold for cross-primer
overlap merging between core-assigned groups. Matches
core's --group-identity default. (default: 0.85)
Merging:
--disable-merging Disable all variant merging (skip MSA-based merge
evaluation entirely)
--enable-merging Override --disable-merging or profile setting
--merge-snp, --no-merge-snp
Enable SNP-based merging (default: True, use --no-
merge-snp to disable)
--merge-indel-length MERGE_INDEL_LENGTH
Maximum length of individual indels allowed in merging
(default: 0 = disabled)
--merge-position-count MERGE_POSITION_COUNT
Maximum total SNP+indel positions allowed in merging
(default: 2)
--merge-min-size-ratio MERGE_MIN_SIZE_RATIO
Minimum size ratio (contributor/merged total) for
merging clusters. Subsets where any contributor is
below this fraction are skipped. (default: 0.1,
0 to disable)
--min-merge-overlap MIN_MERGE_OVERLAP
Minimum overlap in bp for merging sequences of
different lengths (default: 200, 0 to disable)
--disable-homopolymer-equivalence
Disable homopolymer equivalence in merging (treat AAA
vs AAAA as different)
--enable-homopolymer-equivalence
Override --disable-homopolymer-equivalence or profile
setting
--merge-effort LEVEL Merging effort level: fast (8), balanced (10),
thorough (12), or numeric 6-14. Higher values allow
larger batch sizes for exhaustive subset search.
Default: balanced
--hp-normalization-length HP_NORMALIZATION_LENGTH
Minimum homopolymer run length at/above which HP
length differences are blanket-normalized (treated as
noise). Runs shorter than this are surfaced as real
edits in both distance calculations and MSA merging.
Matches core's --hp-normalization-length default.
(default: 6)
Selection:
--select-max-groups SELECT_MAX_GROUPS, --max-groups SELECT_MAX_GROUPS
Maximum number of groups to output per specimen
(default: -1 = all groups)
--select-max-variants SELECT_MAX_VARIANTS, --max-variants SELECT_MAX_VARIANTS
Maximum total variants to output per group (default:
-1 = no limit, 0 also means no limit)
--select-min-size-ratio SELECT_MIN_SIZE_RATIO
Minimum size ratio (variant/group total) to include in
output. The largest variant in each group is always
kept. (default: 0 = disabled, e.g. 0.2 for 20% cutoff)
Consensus output:
--min-position-frequency MIN_POSITION_FREQUENCY
Minimum fraction of non-gap content at a column to
retain the position in merged and -full consensus
sequences. Default 0.5 matches majority-wins behavior.
Set lower (e.g. 0.1) to preserve positions where a
minority of contributors carry content. (default: 0.5)
--min-position-count MIN_POSITION_COUNT
Minimum absolute non-gap support (size-weighted votes
for merging, read count for -full) to retain a column.
Both --min-position-frequency and --min-position-count
must be met. (default: 3)
Performance:
--scale-threshold SCALE_THRESHOLD
Sequence count threshold for scalable mode in HAC
clustering (requires vsearch). Set to 0 to disable.
Default: 1001
--threads N Max threads for internal parallelism. 0=auto-detect
(default), N>0 for explicit count.
The following features support less common workflows and specialized use cases.
Use Case: Calibrating CER and err_factor against your own basecaller version, chemistry, library prep, or amplicon system — without waiting for a shipped update. Typical scenarios: a new Dorado release the suite doesn't yet ship a model for, a non-fungal amplicon system whose error profile differs from the bundled ITS-tuned models, or confirming that a custom flowcell/library prep behaves like the shipped table predicts.
speconsense-fit-error-model productizes the offline q_ctx re-estimation procedure documented in the HP paper §8 / CER paper §4.2 ("Phase 1 deployment regime"). It walks a finished speconsense output tree, applies the paper's selection and filtering, and writes a YAML error model to ~/.config/speconsense/error_models/.
Basic usage:
# Default thresholds (RiC>=200, err_factor<1.0) — matches the v5.0 retune
speconsense-fit-error-model /path/to/clusters --name my-modelThe output model becomes pickable in subsequent runs via --error-model my-model. The tool also prints a comparison against the model the run was clustered under (or --compare-against if explicit), with loud-warns when any key drifts more than 2× from the source — useful for catching cross-basecaller comparisons or material library-prep effects.
Common options:
# Lower thresholds for shallower datasets (paper's ont37 setting)
speconsense-fit-error-model /path/to/clusters --name my-model --min-ric 50
# Tighten the approach-2 non-HP RiC floor (matches paper §8 ont37 methods)
speconsense-fit-error-model /path/to/clusters --name my-model --nonhp-min-ric 20
# Override the auto-detected comparison model
speconsense-fit-error-model /path/to/clusters --name my-model --compare-against dorado-v3.5
# Annotate the YAML frontmatter (chemistry/basecaller default to source-model values)
speconsense-fit-error-model /path/to/clusters --name my-model \
--chemistry R10.4.1 --basecaller "Dorado SUP v5.1" --dataset run123 \
--description "Custom calibration for run123 LSU amplicons"
# Preview without writing
speconsense-fit-error-model /path/to/clusters --name my-model --dry-run
# Write diagnostic TSVs alongside the model
speconsense-fit-error-model /path/to/clusters --name my-model \
--debug-dir /path/to/debug-outputSelection criteria (paper defaults):
--min-ric(default 200): primary anchor must have at least this many reads. Use 50 for lower-depth datasets — the paper's ont37 retune used 50.--max-err-factor(default 1.0): primary anchor'serr_factormust be below this. Acts as a single-template plausibility gate; set 0 to disable.--nonhp-min-ric(default 5): cluster must have at least this many reads to contribute to approach-2 non-HP rate pooling.
How it works (HP paper §8):
- Indexes specimens via
cluster_debug/*-metadata.json(requires schema_version 2.0+ — re-cluster on a current speconsense version if you see schema warnings). - Approach 1 (HP rates): For each qualifying specimen's primary-anchor MSA, identifies HP runs in the consensus, extracts each read's called HP length via flanking-anchor columns, takes the mode across reads as ground truth, and aggregates per
(base, hp_length)context. Bonferroni-corrected binomial outlier and bimodal-distribution filters exclude positions that look like biological HP-only variants. The finalhp-l{N}value is the implied per-position error ratepsuch that(1-p)^Nequals the observed run-level fraction-correct (HP paper §3.5), pooled across bases. - Approach 2 (non-HP rates): Walks every cluster MSA in the tree (regardless of qualification), computes per-position errors against each cluster's own consensus excluding HP runs of length > 1, and pools across clusters. The pooled rates match the operational distribution CER evaluates against in production.
- Source-model comparison: Auto-detects the model the run was clustered under (the most common
parameters.error_modelacross metadata JSONs), loads it viaqctx.load_table, and prints a per-key diff. - YAML output: Writes the model to
~/.config/speconsense/error_models/{name}.yaml, creating the directory if needed. Refuses to overwrite without--force.
Reproducibility check:
Run against the same dataset that produced a shipped model and compare. On /Users/josh/mm/data/ont37/hp-analysis/clusters-2026-05-26-pass2 with paper-matching settings (--min-ric 50 --nonhp-min-ric 20), the tool reproduces dorado-v3.5.yaml essentially exactly (all eight keys within 3% of the shipped values).
See also: the HP error rate paper (docs/hp_error_rate/hp_error_rate_report.pdf) for the empirical foundation and the CER paper (docs/cer_in_practice/cer_in_practice.pdf) §4.2 for the framework's "Phase 1" deployment regime that this tool implements.
Use Case: Reprocessing output from older bioinformatics pipelines (such as minibar) that do not automatically normalize sequence orientation, or data from public repositories where primer-trimming status is inconsistent.
Note: When using speconsense downstream of specimux (recommended workflow), orientation normalization is unnecessary as specimux automatically orients all sequences during demultiplexing.
The --orient-mode parameter enables automatic detection and correction of sequence orientation:
# Primer-based orientation (fast, requires primers with position annotations)
speconsense input.fastq --primers primers.fasta --orient-mode primer
# HMM-based orientation via pyitsx (works on primer-trimmed reads, ITS loci only)
speconsense input.fastq --orient-mode pyitsx
# HMM-based with non-fungal organism group
speconsense input.fastq --orient-mode pyitsx --pyitsx-organism T
# No orientation (default, appropriate when using specimux output)
speconsense input.fastqAvailable modes:
none(default): No orientation performed, sequences processed as-isprimer: Orient via primer matching at read ends; discard reads that fail orientationpyitsx: Orient via ITSx HMM profiles; discard reads that fail orientation or are flagged as chimeric
Both primer and pyitsx modes discard unorientable reads (added to discards file when --collect-discards is enabled).
- Detects orientation by checking for forward and reverse primers at expected positions
- Uses binary scoring: +1 for forward primer match, +1 for reverse primer match
- Sequences with clear orientation (score >0 in one direction, 0 in the other) are reoriented if needed
- Sequences with ambiguous orientation (both 0 or both >0) are discarded
- Requires a primers FASTA with position annotations:
position=forwardorposition=reverse - Fast (~100K reads/sec) but fails on primer-trimmed reads
Primer file format:
>ITS1F pool=ITS position=forward
CTTGGTCATTTAGAGGAAGTAA
>ITS4 pool=ITS position=reverse
TCCTCCGCTTATTGATATGC
- Uses conserved rRNA anchor regions (SSU, 5.8S, LSU) to determine strand
- Works on primer-trimmed reads where primer-based orientation fails
- Detects chimeric sequences (significant HMM hits on both strands)
- ITS loci only — not applicable to other amplicon targets
- ~750 reads/sec (adds ~1s at the default 1000-read presample cap)
Organism groups (--pyitsx-organism, default F):
| Code | Group | Code | Group |
|---|---|---|---|
| F | Fungi | T | Tracheophyta |
| M | Metazoa | B | Bryophyta |
| G | Chlorophyta | H | Rhodophyta |
| O | Oomycota | N | Microsporidia |
Requirements:
- pyitsx:
pip install pyitsx - ITSx must be installed (provides HMM profiles):
conda install bioconda::itsx - Alternatively, set
PYITSX_HMM_DIRto point to the ITSx HMM profile directory
Technical details:
- Orientation occurs before clustering, ensuring all sequences are in the same direction
- Quality scores are reversed when sequences are reverse-complemented
- Chimeric reads (detected by pyitsx) are discarded alongside failed orientations
- The
pyitsx_organismparameter is always recorded in the metadata JSON; summarize uses it for locus labeling (locus=field) regardless of orient-mode
For empirical testing of consensus quality, variant detection, contamination scenarios, and understanding toolchain behavior with controlled datasets, see Testing with Speconsense-Synth.
The following features are under consideration for future development:
-
Background contamination detection tool: A utility to identify contamination patterns affecting multiple specimens within the same sequencing run, helping to distinguish systematic contamination from genuine biological sequences
-
Further scalability improvements: 0.8.x added vsearch-based sparse identity grouping, sparse discard screening, and within-group top-K CER, which collectively make 100K-read inputs tractable. Continued work targets graph clustering for inputs in the hundreds of thousands of reads
These features are being explored based on user feedback. Implementation timelines and feasibility are still being evaluated.
See CHANGELOG.md for detailed version history.
This project uses and builds upon:
-
Markov Clustering (MCL) algorithm:
- van Dongen, S. (2000). Graph Clustering by Flow Simulation. PhD thesis, University of Utrecht. https://micans.org/mcl/
- van Dongen, S. (2008). Graph clustering via a discrete uncoupling process. SIAM Journal on Matrix Analysis and Applications 30(1):121-141. https://doi.org/10.1137/040608635
-
MCL in bioinformatics: Enright, A.J., Van Dongen, S., Ouzounis, C.A. (2002). An efficient algorithm for large-scale detection of protein families. Nucleic Acids Research 30(7):1575-1584. https://doi.org/10.1093/nar/30.7.1575 (PMC: https://pmc.ncbi.nlm.nih.gov/articles/PMC101833/)
-
ONT fungal barcoding protocol: Russell, S.D., Geurin, Z., Walker, J. (2024). Primary Data Analysis - Basecalling, Demultiplexing, and Consensus Building for ONT Fungal Barcodes. protocols.io. https://dx.doi.org/10.17504/protocols.io.dm6gpbm88lzp/v4
Contributions are welcome! For development setup, testing guidelines, and contribution workflow, please see CONTRIBUTING.md.
Speconsense is a playful portmanteau of "Specimen" and "Consensus", reflecting the tool's focus on generating high-quality consensus sequences from specimen amplicon reads.