Skip to content

Latest commit

 

History

History
800 lines (649 loc) · 17.8 KB

File metadata and controls

800 lines (649 loc) · 17.8 KB

vaRRI - Visualizing any RNA-RNA interaction

This Tool creates a visualization for any working inter- and intramolecular structure and sequence involving one or two molecules, using FornaC.

Example interaction between the molecule MicF and IpxR, displayed in this paper
Sequence 1 (blue/purple) is the MicF RNA and Sequence 2 (orange/red) is the IpxR RNA. The basepairs forming the interaction are highlighted using an opague red background. The color grading displays predicted accessibilty data starting at 1, completely accessible, to 0, not accessible.
./rna_to_img.py -o=example.svg \
  --sequence="GCCAGUAGCCUUGCUAUUUCAGUGGCGAAUGAUGAUGCAGGU&GCUAUCAUCAUUAACUUUAUUUAU" \
  --structure="...(((((............(((....(((((((((((....&)).))))))))).))))))))..." \
  --startIndex1=67 \
  --accessibility1="RNAplfold" --accessibility2="RNAplfold"

Overview

Dependency Installation

After cloning the repository, we just need to install

  • playwright (tested and developed with v1.57.0)
  • chromium browser (install via playwright)
# install dependencies
python3 -m pip install playwright==1.57.0
python3 -m playwright install chromium
# check version
python3 -m playwright --version

For structure prediction and accessibility data prediction, vaRRI uses RNAplfold and RNAfold from the ViennaRNA package. Recommended installation using Miniconda

# setup bioconda
conda config --add channels defaults
conda config --add channels bioconda
conda config --add channels conda-forge
conda config --set channel_priority strict
# install viennaRNA package
conda install viennarna

Features

Mandatory Parameters

--structure Specifies the RNA secondary structure in dot-bracket notation.
Notation Meaning
( ) Base pair
[ ] Alternative bracket pair
< > Alternative bracket pair
{ } Alternative bracket pair
. Unpaired nucleotide
& Separator between two molecules (intermolecular interaction)
intramolecular:

rna_to_img.py \
  -u="((...))...." \
  -e="NNNNNNNNNNN"
intermolecular:

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN"
Hybrid Input Format (Advanced)

The hybrid input format provides a convenient way to specify intermolecular base pairing interactions using position indices instead of dot-bracket notation.

Format:

<start_pos_1><pipes_and_dots>&<start_pos_2><pipes_and_dots>

Where:

  • <start_pos>: Starting position (index, can be negative, can not be 0)
  • |: Represents a base pair in the intermolecular interaction
  • .: Represents an unpaired position within the interaction region

How it works:

  • Both molecules must have the same number of | characters (representing the same number of base pairs)
  • Interaction positions are defined relative to your sequence start Index
  • The tool automatically converts hybrid input to standard dot-bracket notation
Example (simple interaction):
Two sequences with interaction starting at position 5 (seq1) and position 3 (seq2) and each has 3 intermolecular base pairs

./rna_to_img.py \
  -u="5|||..&3|||.." \
  -e="NNNNNNNNNNNNN&NNNNNNN"

Example (with custom start Index)
Start indexing from position 10 (seq1) and 100 (seq2)
Interaction starts at position 15 (seq1) and 102 (seq2)

rna_to_img.py \
  -u="15|||..&102|||.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  -i1=10 \
  -i2=100

Example (negative positions):
start indexing form -10 (seq1) and 1 (seq2)
Interaction starts at position -5 (seq1) and 3 (seq2)

rna_to_img.py \
  -u="-5|||..&3|||.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  -i1=-10 \
  -i2=1


Hybrid vs. Dot-Bracket Comparison: These two commands are equivalent:

Hybrid format:

rna_to_img.py \
  -u="5|||..&3|||" \
  -e="NNNNNNNNNNNNNN&NNNNN"
Equivalent dot-bracket format:

rna_to_img.py \
  -u="....(((......&..))).." \
  -e="NNNNNNNNNNNNN&NNNNNNN"

--sequence Specifies the RNA sequence using IUPAC nucleotide codes (see also --fastafile)
Code Nucleotide Code Nucleotide
A Adenosine N Any nucleotide
C Cytidine W Adenosine or Uridine
G Guanosine S Cytidine or Guanosine
U Uridine K Guanosine or Uridine
& Separator between two molecules
Example:

rna_to_img.py -u=".((...))." -e="AACGAGUGA"

Optional Parameters

-o/ --output Specifies the output file name and format
Value Description
STDOUT (default) Print SVG to standard output
filename Save as SVG with given name
filename.png Save as PNG with given name

Examples:

# Output to stdout
rna_to_img.py -u="((...))." -e="ACGAGUGA" > output.svg

# Save as SVG file
rna_to_img.py -u="((...))." -e="ACGAGUGA" -o=structure

# Save as PNG file
rna_to_img.py -u="((...))." -e="ACGAGUGA" -o=structure.png
-c/ --coloring Defines how nucleotides should be colored
Option Description Example
loop Standard fornac coloring scheme
strand (default) Each molecule receives its own color
Example:

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  -c=strand
-H/ --highlighting Specifies the highlighting mode for intermolecular structures
Option Example Image
nothing: no sepcial highlighting

rna_to_img.py \
  -u="((...))..<<....<<..&..>>...>>.." \
  -e="NNNNNNNNNNNNNNNNNNN&NNNNNNNNNNN" \
  -H=nothing \
  -c=loop

basepairs: Highlights only individual intermolecular base pairs

rna_to_img.py \
  -u="((...))..<<....<<..&..>>...>>.." \
  -e="NNNNNNNNNNNNNNNNNNN&NNNNNNNNNNN" \
  -H=basepairs

region(default): Highlights entire intermolecular interaction region

rna_to_img.py \
  -u="((...))..<<....<<..&..>>...>>.." \
  -e="NNNNNNNNNNNNNNNNNNN&NNNNNNNNNNN" \
  -H=region

-bH/ --backgroundhighlighting Specifies the background highlighting mode for intermolecular interactions
Option Description
nothing no background highlighting
basepairs (default) highlights intermolecular basepair stacking
region highlights the full intermolecular interaction region
rna_to_img.py \
  --structure="((...))..<<..&...>>.." \
  --sequence="NNNNNNNNNNNNN&NNNNNNN" \
  -bH=region
-i1/ --startIndex1, -i2/ --startIndex2 Sets the starting index for each molecule
Parameter Constraint
Default 1
Restriction Cannot be 0
Example: Indexing starts with 10

rna_to_img.py \
  -u="..((...))." \
  -e="AAACGAGUGA" \
  -i1=10
Example: Both molecules have different start indicies

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  -i1=5 \
  -i2=100
-v/ --verbose Enables detailed logging output for debugging and troubleshooting
./rna_to_img.py -u="((...))." -e="ACGAGUGA" -v
-l/ --labelInterval Defines how often labels with indices are displayed
Option Description
n Shows index labels every n nucleotides
10 default
rna_to_img.py \
  -u="((...))....((...))" \
  -e="ACGAGUGAACGAGUGA" \
  -l=5
--crop, --crop1, --crop2 Crops sequences around the intermolecular interaction region
Parameter Description
--crop Applies cropping to both molecules
--crop1 Crops only the first molecule
--crop2 Crops only the second molecule
rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  --crop=5
--highlightSubseq1, --highlightSubseq2 Highlights specific subsequences
Parameter Description
--highlightSubseq1 Subsequences in first molecule
--highlightSubseq2 Subsequences in second molecule
rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  --highlightSubseq1="1:2,5:10"
--guBasepairs Controls visualization of G-U base pairs
Option Description
Enabled (default) G-U basepairs shown as dashed lines
Disabled No special visualization
rna_to_img.py \
  -u="((...))" \
  -e="GUGUGUGU" \
  --guBasepairs
--fastafile Load one or two sequences from a FASTA file
rna_to_img.py \
  --fastafile=example.fasta \
  -u="((...))"
--predictStructure1, --predictStructure2 Enable intramolecular structure prediction
Flag Option Description
Enabled Predict intramolecular structure for each molecule. Using RNAfold with constraints: --structure given Basepairs
Disabled (default) No structure prediction
rna_to_img.py \
  -e="ACGAGUGA" \
  --predictStructure1
--forcefield Activates fornac’s force-directed layout forcefield
rna_to_img.py \
  -u="((...))" \
  -e="ACGAGUGA" \
  --forcefield=0
--accessibility1, --accessibility2 Visualize nucleotide accessibility
Option Description
None (default) No visualization
RNAplfold Predict accessibility using RNAplfold
path/to/file Use precomputed lunp file
rna_to_img.py \
  -u="((...))" \
  -e="ACGAGUGA" \
  --accessibility1="RNAplfold"
--RNAfold Pass custom parameters to RNAfold
rna_to_img.py \
  -e="ACGAGUGA" \
  --predictStructure1 \
  --RNAfold="-T20"
--RNAplfold Pass custom parameters to RNAplfold
rna_to_img.py \
  -e="ACGAGUGA" \
  --accessibility1="RNAplfold" \
  --RNAplfold="-T20"

Usage Examples

Simple Intramolecular Structure
Visualization of a single RNA molecule with one hairpin loop:

rna_to_img.py -u=".((...))." -e="AACGAGUGA" > hairpin.svg

Intermolecular Interaction with Distinct Coloring
Two molecules interacting where each molecule has its own color:

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  -c=strand \
  -o=interaction.svg

Custom Indexing
Start numbering from different positions for each molecule:

rna_to_img.py \
  -u="((...))..<<..&...>>.." \
  -e="NNNNNNNNNNNNN&NNNNNNN" \
  -i1=5 -i2=100 \
  -o=custom_index.svg

Pseudoknot Structure (Kissing Hairpins)
A basic pseudoknot involving two interacting hairpin structures:

rna_to_img.py \
  -u="<<<..((..>>>&<<<..))..>>>" \
  -e="NNNNNNNNNNN&NNNNNNNNNNNN" \
  -c=strand \
  -o=pseudoknot_simple.svg

Pseudoknot Structure (Complex - Double Kissing Hairpins)
Two molecules forming a complex kissing hairpin interaction:

rna_to_img.py \
  -u="<<<..(((..>>>...<<<..(((..>>>..&<<<..)))..>>>...<<<..)))..>>>.." \
  -e="NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN&NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN" \ 
  -c=strand \ 
  -o=kissing_hairpins.svg